DNA/RNA Motif Search
Home

 DNA/RNA Motif Search   

Database
Motif
 
DNA RNA
 
Sample Input/Results:
Example: T. forsythensis
Motif: 'ACAGNNNNNNNAAACNNNAAT'

motifSearch is searching file 'tfor.genome' for the motif 'ACAGNNNNNNNAAACNNNAAT' in frame 0.

ID          start          stop           strand   matching_pattern
TFOR        1074656        1074676        +        ACAGCAAATACAAACAGCAAT
TFOR        3003896        3003916        -        ACAGTACTCGCAAACGATAAT
Total Hits = 2

When ambiguity code for a single base is introduced, more hits are found. For example, a 'W' is put in place of an 'A'. MotifSearch is searching file 'tfor.genome' for the motif 'ACAGNNNNNNNAAACNNNAWT' in frame 0.

ID          start          stop           strand   matching_pattern
TFOR        1074656        1074676        +        ACAGCAAATACAAACAGCAAT
TFOR        185154         185174         -        ACAGTGCCGTAAAACCCTATT
TFOR        3003896        3003916        -        ACAGTACTCGCAAACGATAAT
Total Hits = 3

When another ambiguity code 'R' is added, more hits are returned. MotifSearch is searching file 'tfor.genome' for the motif 'RCAGNNNNNNNAAACNNNAWT' in frame 0.

ID          start          stop           strand   matching_pattern
TFOR        1074656        1074676        +        ACAGCAAATACAAACAGCAAT
TFOR        1288596        1288616        +        GCAGATCCGAAAAACGGAAAT
TFOR        3257412        3257432        +        GCAGAGTGGATAAACGAAAAT
TFOR        185154         185174         -        ACAGTGCCGTAAAACCCTATT
TFOR        3003896        3003916        -        ACAGTACTCGCAAACGATAAT
Total Hits = 5
DNA ambiguity codes are provided below:
Code      Meaning         	Etymology         		Complement      Opposite
A         A                   	Adenosine         		T         	B
T/U       T         		Thymidine/Uridine       	A         	V
G         G         		Guanine         		C         	H
C         C         		Cytidine         		G         	D
K         G or T         	Keto         			M         	M
M         A or C         	Amino         			K         	K
R         A or G         	Purine         			Y         	Y
Y         C or T         	Pyrimidine         		R         	R
S         C or G         	Strong         			S         	W
W         A or T         	Weak         			W         	S
B         C or G or T         	not A (B comes after A)         V         	A
V         A or C or G         	not T/U (V comes after U)       B         	T/U
H         A or C or T         	not G (H comes after G)         D         	G
D         A or G or T         	not C (D comes after C)         H         	C
X/N       G or A or T or C      any         			N         	.

Operated by Los Alamos National Security, LLC for the U.S. Department of Energy's National Nuclear Security Administration
Inside | © Copyright 2006 LANS LLC All rights reserved | Disclaimer/Privacy