motifSearch is searching file 'tfor.genome' for the motif 'ACAGNNNNNNNAAACNNNAAT' in frame 0.
ID start stop strand matching_pattern TFOR 1074656 1074676 + ACAGCAAATACAAACAGCAAT TFOR 3003896 3003916 - ACAGTACTCGCAAACGATAAT Total Hits = 2
When ambiguity code for a single base is introduced, more hits are found. For example, a 'W' is put in place of an 'A'. MotifSearch is searching file 'tfor.genome' for the motif 'ACAGNNNNNNNAAACNNNAWT' in frame 0.
ID start stop strand matching_pattern TFOR 1074656 1074676 + ACAGCAAATACAAACAGCAAT TFOR 185154 185174 - ACAGTGCCGTAAAACCCTATT TFOR 3003896 3003916 - ACAGTACTCGCAAACGATAAT Total Hits = 3
When another ambiguity code 'R' is added, more hits are returned. MotifSearch is searching file 'tfor.genome' for the motif 'RCAGNNNNNNNAAACNNNAWT' in frame 0.
ID start stop strand matching_pattern TFOR 1074656 1074676 + ACAGCAAATACAAACAGCAAT TFOR 1288596 1288616 + GCAGATCCGAAAAACGGAAAT TFOR 3257412 3257432 + GCAGAGTGGATAAACGAAAAT TFOR 185154 185174 - ACAGTGCCGTAAAACCCTATT TFOR 3003896 3003916 - ACAGTACTCGCAAACGATAAT Total Hits = 5DNA ambiguity codes are provided below:
Code Meaning Etymology Complement Opposite A A Adenosine T B T/U T Thymidine/Uridine A V G G Guanine C H C C Cytidine G D K G or T Keto M M M A or C Amino K K R A or G Purine Y Y Y C or T Pyrimidine R R S C or G Strong S W W A or T Weak W S B C or G or T not A (B comes after A) V A V A or C or G not T/U (V comes after U) B T/U H A or C or T not G (H comes after G) D G D A or G or T not C (D comes after C) H C X/N G or A or T or C any N .