Gene ID:HHVTW076
GenBank Locus Tag:
DNA Molecule Name:
1
GenBank ID:
1869896
Gene Name:
alpha47 US12
Definition:
TAP1/2 binding protein,ICP47, IE12
Cellular Location:
[Evidence]
Gene Start:
148035
Gene Stop:
147775
Gene Length:
261
Molecular Weight*:
9768
pI*:
7.20
Net Charge*:
0.28
EC:
Functional Class:
virulence factor; blocks antigen presentation
Gene Ontology:
Pathway: pathway table
Secondary Evidence:
Pfander R, Neumann L, Zweckstetter M, Seger C, Holak TA, Tampe R, Structure of the active domain of the herpes simplex virus protein ICP47 in water/sodium dodecyl sulfate solution determined by nuclear magnetic resonance spectroscopy, Biochemistry 1999 Oct 12;38(41):13692-8, Medline: 99452710.
Cassady KA, Gross M, Roizman , The second-site mutation in the herpes simplex virus recombinants lacking the gamma134.5 genes precludes shutoff of protein synthesis by blocking the phosphorylation of eIF-2alpha, J Virol 1998 Sep;72(9):7005-11, Medline: 98362101.
Jugovic P, Hill AM, Tomazin R, Ploegh H, Johnson DC, Inhibition of major histocompatibility complex class I antigen presentation in pig and primate cells by herpes simplex virus type 1 and 2 ICP47,
J Virol 1998 Jun;72(6):5076-84, Medline: 98241749.
He B, Chou J, Brandimarti R, Mohr I, Gluzman Y, Roizman B, Suppression of the phenotype of gamma(1)34.5- herpes simplex virus 1: failure of activated RNA-dependent protein kinase to shut off protein synthesis is associated with a deletion in the domain of the alpha47 gene, J Virol 1997 Aug;71(8):6049-54, Medline: 97366667.
Hill A, Jugovic P, York I, Russ G, Bennink J, Yewdell J, Ploegh H,
Johnson D, Herpes simplex virus turns off the TAP to evade host immunity, Nature 1995 Jun 1;375(6530):411-5, Medline: 95281055.
Nishiyama Y, Kurachi R, Daikoku T, Umene K, The US 9, 10, 11, and 12 genes of herpes simplex virus type 1 are of no importance for its neurovirulence and latency in mice, Virology 1993 May;194(1):419-23, Medline: 93242779.
Umene K, Short, duplicated sequence indicative of the recombinogenicity of the junction between a unique and an inverted repeat sequence in the S component of the herpes simplex virus type 1 genome, J Virol 1989 May;63(5):1877-83, Medline: 89199738.
Longnecker R, Roizman B, Clustering of genes dispensable for growth in culture in the S component of the HSV-1 genome, Science 1987 May 1;236(4801):573-6, Medlin: 87206161,
McGeoch DJ, Dolan A, Donald S, Brauer DH, Complete DNA sequence of the short repeat region in the genome of herpes simplex virus type 1, 1 : Nucleic Acids Res 1986 Feb, 25;14(4):1727-45, Medline: 86148504 .
Watson RJ, Vande Woude GF, DNA sequence of an immediate-early gene
(IEmRNA-5) of herpes simplex virus type I, Nucleic Acids Res 1982 Feb 11;10(3):979-91, Medline: 82150256.
Comment:
Hill et.al.(1995) demonstrate that the alpha47 protein (ICP47/US12) inhibits peptide transport by binding TAP1/2, and blocks the transport of peptides for antigen presentation to CD8+ cells.
There are no reported counterparts to this gene in Alphaherpesvirinae other than HSV-1. In HSV-1 alpha47 is dispensable for growth in cell culture, see Longecker and Roizman (1987) and has alpha expression regulation (Roizman, PNAS 93:11307 1996, Medline: 97030190).
Blast Summary: PSI-Blast Search
Residues 1-55 of ICP47 are 67% similar using gapped BLAST to residues 1-55 of ICP47 in Human herpesvirus 1 (strain 17).
Variants include AAA45849 and P14345.
Top Blast Hits: Updated monthly
Click here to view the entire PsiBlast results.
COGS Summary: COGS Search
None.
Blocks Summary: Blocks Search
Residues 57-66 may represent block PR01149D (Melatonin 1A receptor signature) with combined E value 0.99, 7 aa out of 10 match.
ProDom Summary: Protein Domain Search
Residues 1-62 and 63-86 constitute the immediate-early protein domains as seen in P89480_VVVVV. Residues 40-73 are 41% similar to a leucine-rich neuronal protein domain as seen in O75427_HUMAN.
Paralogs: Local Blast Search
None.
Pfam Summary: Pfam Search
None.
Top PDB Hits:
None.
Gene Protein Sequence:
MSWALKTTDMFLDSSRCTHRTYGDVCAEIHKREREDREAARTAVTDPELP
LLCPPDVRSDPASRNPTQQTRGCARSNERQDRVLAP$
Gene Nucleotide Sequence: Sequence Viewer
ATGTCTTGGGCCCTGAAAACGACGGACATGTTTCTGGATTCTTCGCGGTG
CACACACCGGACGTATGGCGATGTCTGCGCGGAGATCCATAAAAGGGAAC
GGGAGGACCGAGAGGCGGCCAGAACTGCGGTGACCGACCCGGAGCTCCCG
CTGCTGTGTCCTCCGGACGTGCGATCGGATCCCGCGAGTCGAAATCCCAC
ACAGCAGACCCGTGGGTGTGCTAGATCGAACGAGCGGCAGGATCGCGTGC
TGGCCCCTTGA